The Riggs/Rigg DNA Website
A YDNA signature (also called a haplotype) is simply a list of numbers. A 12-marker test has 12 numbers, a 25-marker test has 25, etc. The order of signature numbers is carefully defined by FamilyTreeDNA.
Example: Here is the YDNA signature for Edward Riggs, immigrant to New England in 1633:
12 24 14 11 14 16 12 12 12 13 13 29 (from a 12-marker test)
19 9 10 11 11 25 15 19 29 15 15 17 17 (from a 25-marker test, added to the string of numbers above)
11 10 19 23 15 15 17 18 37 38 12 12 (from a 37-marker test, added to both strings of numbers above)
11 9 15 16 8 10 10 8 11 10 12 21 23 16 10 12 12 15 8 12 23 20 13 12 11 13 11 11 12 12 (from a 67-marker test, added to the three strings above)
Each of these numbers is a repeat count. For instance, the first number, 12, means that a certain short sequence of the letters A, T, C, or G is repeated over and over 12 times at marker position number 1.
The A, T, C, and G are the "code" in which DNA is written. They are called nucleotides. The actual sequence doesn't matter to us, only its repeat count.
Example: The 11 on the 4th marker above means that the nucleotide sequence TCTA is repeated 11 times on the Y chromosome of Edward Riggs.
TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTA is what actually appears on Edward's Y chromosome at marker 4.
For perspective, the human Y chromosome has 58 million A, T, C, or Gs in its full length, so we look at only a very tiny portion of it for our test. And there are 22 other chromosomes we do not look at, containing billions of A, T, C, and Gs.
One of the things we look for are mutations.
The company used for this DNA study is
Browse my entire site. Or my genealogy site. Or just the special Edwardian Riggs site.
Alvy Ray Smith, Group Administrator